Ortopedik Uygulamalar İçin Nanoyapılı Cam Seramik Kaplamalar-Bölüm 3


2.2 Bağlanma kuvveti ve mikro sertlik

   Kaplama arasındaki gerilme dayanımı ve   Alt tabaka   oldu   ölçülü   içinde   uyum   ile   ASTM   Cı-633-79.     test yapmak   prosedür   kutu   olmak   bulunan   içinde   önceki çalışmamız [ 32 ]. Beş örnek bağımsız olarak test edildi   için   her   tip   arasında   kaplamalar   ve     Sonuçlar   rapor edildi   gibi   ortalama ± sd

Kaplamaların mikro sertliği, bir Shimadzu mikro sertlik test cihazı (Shimadzu Co., Japonya) kullanılarak 300 gf'lik bir yük ile cilalı kaplama yüzeylerinde test edildi ve   bir   Yükleniyor   zaman   arasında   15 s.   Önce   test yapmak,   kaplamalar   tabi tutuldu   için   fi ne   cilalama.   Sertlik   değerler   kaydedildi   üzerinde   15   farklı   pozisyonlar.  

  Sonuçlar   sunuldu   gibi   anlamına gelmek ± sd

 


Tablo 1. RT-PCR-HOB ile ilişkili markörler için kullanılan primerler.


gen

sıra   ( 5 '   - 3 ' )

erime sıcaklığı (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


kollajen tip I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. İyon salımı ve hücresel cevherleşme testleri

     HT ve SP kaplamalarının iyon salma davranışlarını ölçmek için, 7 gün boyunca, tris (hidroksimetil) aminometan ve hidroklorik asit (HCl-Tris tamponlu çözelti) ile tamponlanmış 15 ml'lik bir sodyum klorür çözeltisi (pH 7.4) içine daldırılmıştır. Islatma işleminden sonra, tamponlanmış çözeltinin pH değerleri ölçülmüş ve iyon konsantrasyonları, indüktif darbe ile çalışan plazma atomik emisyon spektroskopisi (ICP-OES, Optima 3000 DV, ABD) ile test edilmiştir.

Kaplamaların Ca ve fosfor (P) bileşiklerinin çökelmesini indükleme kabiliyeti, hücreler içermeyen kültür ortamında kaplamaların batırılmasıyla değerlendirilmiştir. Kısaca, kaplamalar gece boyunca% 70 etanol çözeltisine daldırılarak sterilize edildi ve daha sonra kültür ortamında ıslanmadan önce fosfat tamponlu salin (PBS) ile yıkandı. Kaplama numuneleri içeren 12-kuyulu kültür plakasının her oyuğuna üç mililitre kültür ortamı eklenmiştir. Kaplama numuneleri, 5 saat boyunca nemlendirilmiş,% 5 C02 atmosferinde 37 ° C'de inkübe edildi ve daha sonra ultra saf su ile yıkandı, kurutuldu ve SEM gözlemi için karbon püskürtülerek geçirildi. Mineralizasyondan sonra kaplama yüzeyinde oluşan tortuların kimyasal bileşimi, SEM cihazına bağlı olan enerji-dispersif spektroskopisi (EDS) kullanılarak analiz edilmiştir.


2.4. Birincil insan osteoblastlarının izolasyonu ve kültürü

Atılmış insan dokusunun kullanılmasına izin, Sydney Üniversitesi İnsan Etik Kurulu tarafından verildi ve bilgilendirilmiş onam alındı. Birincil insan osteoblastları (HOB), daha önce tarif edildiği gibi normal insan trabeküler kemiğinden izole edildi [34]. Kısaca, kemik 1 mm3 parçaya bölünmüştür, PBS içinde birkaç kez yıkanmıştır ve PBS, pH 7.4'te, 0.03 (37 g / hac) tripsin (Sigma –Aldrich, ABD) ile 37 ° C'de 90 dakika boyunca sindirilmiştir. Hücreler daha sonra yüzde 10 (v / v) ısı ile inaktif hale getirilmiş fetal dana serumu (FCS, Gibco Laboratories), 2 mM ile takviye edilmiş bir asgari esansiyel ortam (a-MEM, Gibco Laboratories, ABD) içeren tam bir ortam içinde kültürlendi. L-glutamin (Gibco Laboratories), 25 mM Hepes tamponu (Gibco Laboratories), 2 mM sodyum piruvat, 30 mg ml- 1 penisilin, 100 mg ml- 1 streptomisin (Gibco Laboratories) ve 0.1 mM L-askorbik asit fosfat magnezyum tuzu ( Wako Pure Chemicals, Osaka, Japonya). Hücreler% 5 C02 atmosferinde 37 ° C'de kültürlendi ve ortam üç günde bir yenilendi. Birbirine bağlı olarak, hücreler pasajlandı ve deneylerde 3 geçişindekiler kullanıldı.



2.5. Hücre eki ve morfolojik gözlem

Hücreler% 80-90 konfluansa ulaştıktan sonra, TrypLE Express (Invitrogen) kullanılarak tripsinize edilmiş, daha sonra santrifüjlenmiş ve mililitrede 3.4 x 104 hücre yoğunluğunda bir hücre süspansiyonu üretmek için tam ortam içinde süspanse edilmiştir. Daha sonra, kaplama numuneleri içeren 24-kuyucuklu bir hücre kültür plakasının her oyuğuna 1 ml'lik bir hücre süspansiyonu ilave edildi. 2, 5 ve 24 saat boyunca kültüre edildikten sonra hücreler% 4 paraformaldehid solüsyonunda sabitlendi, 1 saat boyunca PBS içinde% 1 osmiyum tetroksid kullanarak sonradan sabitlendi, sonra bir dizi dereceli etanol çözeltisi içinde dehidre edildi (30, 50, 70, 90, 95 ve% 100) ve son olarak 3 dakika boyunca heksametildisilizan içinde kurutuldu. Kurutulmuş kaplama örnekleri, SEM gözleminden önce altın püskürtülmüştür.



2.6. Hücre çoğalma analizi

Canlı hücrelerin sayısının saptanması için CellTiter 96 Sulu Test (Promega, ABD), bir kolorimetrik yöntem kullanıldı. Analiz, bir tetrazolyum bileşiği 3- (4,5-dimetiltiyazol-2-il) -5- (3-karboksimetoksifenil) -2- (4-sülfofenil-2H-tetrazolyum) (MTS) ve bir elektron birleştirme reaktifi içeren birleştirilmiş bir çözeltidir. 20: 1'lik bir hacim oranı ile (fenazin metosülfat). Önceki bileşik, canlı hücreler tarafından hücre kültür ortamı içinde çözünebilen bir formazana dönüştürülebilir. Yani, formazan'ın 490 nm'deki absorbansı, canlı hücrelerin sayısıyla doğru orantılıdır. Her bir kaplama tipi için dört örnek her bir zaman noktası için test edildi ve kaplanmamış Ti-6Al-4V diskleri bir kontrol olarak kullanıldı. Kısaca, 8.5 x 104 hücre ml- 1 hücre yoğunluğuna sahip 1 ml'lik hücre süspansiyonu, kaplama numunelerini içeren 24-kuyucuklu bir kültür plakasının her oyuğuna eklenmiştir. 3 ve 7 gün sonra, kültür ortamı, PBS içinde CellTiter 96 Sulu Testin beş kez seyreltilmiş çözeltisi olan MTS çalışma çözeltisinin 700 ul'si ile değiştirildi. 4 saat daha inkübasyondan sonra, 100 ml çalışma solüsyonu, 490 nm'de bir mikroplaka okuyucusu (PathTech) kullanılarak absorbansı ölçmek için 96 kuyucuklu bir hücre kültür plakasına aktarıldı.


2.7. Kantitatif gerçek zamanlı polimeraz zincir reaksiyonu

HOB'lar 2 x 104 hücre cm2 hücre yoğunluğunda kaplama örneklerine ekildi ve 1 gün ve 7 gün boyunca kültürlendi . Her bir zaman noktasından sonra, toplam RNA, kaplama örnekleri üzerinde kültürlenen HOB'lardan ve üreticinin talimatlarına göre Trizol (Sigma) kullanılarak kaplanmamış Ti-6Al-4V disklerinin kontrol numunelerinden izole edildi . Birinci sarmal cDNA, üreticinin talimatlarına göre Omniscript RT Kit (Qiagen, ABD) kullanılarak 0.7 ug toplam RNA'dan sentezlendi. Daha sonra cDNA, osteoblast ile ilgili genler için gerçek zamanlı PCR (Rotor-Gene 6000, Corbett Life Science) ile analiz edildi: Runx-2, kollajen tip I, osteopontin (OPN) ve kemik sialoprotein (BSP) ve bunların nispi gen ekspresyonu gliseraldehit 3-fosfat dehidrojenaz (GAPDH) ile normalize edilerek seviyeler elde edildi.

Seçilen genler için kullanılan primerler tablo 1'de listelenmiştir.


2.8. istatistiksel analiz

Veriler dört bağımsız deneyden elde edildi ve ortalama ± sd olarak ifade edildi. İstatistiksel analiz için SPSS 17.0 programı kullanıldı. Tüm veriler için varyansın homojenliğini belirlemek üzere Levene testi uygulanmış ve homojen varyanslı veriler için Tukey HSD post hoc testleri kullanıldı, aksi takdirde, Tamhane'nin T2 post hoc'u kullanıldı.

0.05'ten küçük bir p değeri anlamlı olarak değerlendirildi.



******devam edecek******